AI Bio 소식
[Accegen 공식 대리점] MicroRNA Agomir/Antagomir(AM4489)
- AI바이오허브 오래 전 2025.03.04 23:29 Bulletin Board 인기
-
235
0
MicroRNA Agomir/Antagomir
MIRacle™ mmu-miR-8106 miRNA Agomir/Antagomir
Species:Mouse
Cat.No:AM4489
Product Category:MicroRNA Agomir/Antagomir
Size/Quantity:2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)
Shipping Info:Room Temperature
Storage:-20°C / -80°C
Product Type:microRNA Agomir/Antagomir
Label:FAM, CY3, CY5, etc. (optional)
Component
mmu-miR-8106 Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)
Key Features
*cover all human, mouse, and rat miRNAs listed in miRBase
*higher stability/inhibitory effects in vivo and in vitro
*more stable, easier to pass the cell membrane and tissue gap
*purified and ready-to transfect cells/be administered by injection, inhalation, feeding
*less reagent use amount with longer effect time
Description
MicroRNA: mmu-miR-8106
Accession Number: MIMAT0031411
Mature Sequence: UGACUCUGUACAUGGCAUUUAU
mmu-miR-8106 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA
precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis,
and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional
or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-8106 in miRBase.
What is MicroRNA Agomir/Antagomir?
MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA
to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist.
It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes,
thereby inhibiting miRNAs from functioning.
Why choose mmu-miR-8106 miRNA Agomir/Antagomir from AcceGen?
AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat
miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are
more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in
in vitro or in vivo miRNA functional studies.
- 이전글[Apollo Scientific 공식 대리점]1-[2-(Pyridin-4-yl)ethyl]piperazine (OR0069)2025.03.05
- 다음글[Five Photon 공식 대리점]Fivephoton Membrane Potential Dye Ion Channel Assay Kit(MPF-Kit)2025.03.04
댓글목록
등록된 댓글이 없습니다.
